ZMYND8 Knockout Cell Line - CD BioSciences

service-banner

ZMYND8 Knockout Cell Line

ZMYND8 Knockout Cell Line

SPL-04061

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name ZMYND8
Gene Abbr. ZMYND8
Gene ID 23613
Full Name zinc finger MYND-type containing 8
Alias PRKCBP1, PRO2893, RACK7
Species Human
Genomic Locus chr20:47310127
Transcript NM_012408
WT Expression Level 61.34 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a receptor for activated C-kinase (RACK) protein. The encoded protein has been shown to bind in vitro to activated protein kinase C beta I. In addition, this protein is a cutaneous T-cell lymphoma-associated antigen. Finally, the protein contains a bromodomain and two zinc fingers, and is thought to be a transcriptional regulator. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of ZMYND8.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence TTCCAATGGCCACTCGCCGC
PCR Primer Forward: GTATATTCTGGGAGGAGGAACACTG
Reverse: CTTACAAGGATCCAGAGGTTCAGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.