ZMYND11 Knockout Cell Line - CD BioSciences

service-banner

ZMYND11 Knockout Cell Line

ZMYND11 Knockout Cell Line

SPL-04058

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name ZMYND11
Gene Abbr. ZMYND11
Gene ID 10771
Full Name zinc finger MYND-type containing 11
Alias BRAM1, BS69, MRD30
Species Human
Genomic Locus chr10:180021
Transcript NM_001202464
WT Expression Level 27.83 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of ZMYND11.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence TTTAACAAAAAGACGACAGG
PCR Primer Forward: TAACTGGTGATGTGGATGGTAGAAA
Reverse: CCCCAAAGTCTTCTACGACATTTTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.