Online Inquiry
ZMYND11 Knockout Cell Line
SPL-04057
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 31bp deletion |
| Target Information | |
|---|---|
| Target Name | ZMYND11 |
| Gene Abbr. | ZMYND11 |
| Gene ID | 10771 |
| Full Name | zinc finger MYND-type containing 11 |
| Alias | BRAM1, BS69, MRD30 |
| Species | Human |
| Genomic Locus | chr10:180021 |
| Transcript | NM_001202464 |
| WT Expression Level | 27.83 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 31bp deletion in a coding exon of ZMYND11. |
| Description | 31bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTTAACAAAAAGACGACAGG |
| PCR Primer |
Forward: TAACTGGTGATGTGGATGGTAGAAA Reverse: CCCCAAAGTCTTCTACGACATTTTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.