ZMYM3 Knockout Cell Line - CD BioSciences

service-banner

ZMYM3 Knockout Cell Line

ZMYM3 Knockout Cell Line

SPL-04056

Size Price
1 Unit Online Inquiry
Description
74bp insertion
Target Information
Target Name ZMYM3
Gene Abbr. ZMYM3
Gene ID 9203
Full Name zinc finger MYM-type containing 3
Alias DXS6673E, MYM, XFIM, ZNF198L2, ZNF261
Species Human
Genomic Locus chrX:71253123
Transcript NM_201599
WT Expression Level 62.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene is located on the X chromosome and is subject to X inactivation. It is highly conserved in vertebrates and most abundantly expressed in the brain. The encoded protein is a component of histone deacetylase-containing multiprotein complexes that function through modifying chromatin structure to keep genes silent. A chromosomal translocation (X;13) involving this gene is associated with X-linked mental retardation. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 74bp insertion in a coding exon of ZMYM3.
Description 74bp insertion
Parental Cell Line C631
Guide RNA Sequence GACTGCCCCAACTCGAGGAT
PCR Primer Forward: CTCTAGGGTCTGATCTCCTGCATC
Reverse: TACATATCCAGCCATACTCATGGAC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.