Online Inquiry
ZMYM3 Knockout Cell Line
SPL-04055
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
302bp insertion |
Target Information | |
---|---|
Target Name | ZMYM3 |
Gene Abbr. | ZMYM3 |
Gene ID | 9203 |
Full Name | zinc finger MYM-type containing 3 |
Alias | DXS6673E, MYM, XFIM, ZNF198L2, ZNF261 |
Species | Human |
Genomic Locus | chrX:71253123 |
Transcript | NM_201599 |
WT Expression Level | 62.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene is located on the X chromosome and is subject to X inactivation. It is highly conserved in vertebrates and most abundantly expressed in the brain. The encoded protein is a component of histone deacetylase-containing multiprotein complexes that function through modifying chromatin structure to keep genes silent. A chromosomal translocation (X;13) involving this gene is associated with X-linked mental retardation. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 302bp insertion in a coding exon of ZMYM3. |
Description | 302bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GACTGCCCCAACTCGAGGAT |
PCR Primer |
Forward: CTCTAGGGTCTGATCTCCTGCATC Reverse: TACATATCCAGCCATACTCATGGAC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.