Online Inquiry
ZMIZ2 Knockout Cell Line
SPL-04052
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | ZMIZ2 |
| Gene Abbr. | ZMIZ2 |
| Gene ID | 83637 |
| Full Name | zinc finger MIZ-type containing 2 |
| Alias | NET27, TRAFIP20, ZIMP7, hZIMP7 |
| Species | Human |
| Genomic Locus | chr7:44757064 |
| Transcript | NM_174929 |
| WT Expression Level | 17.48 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | ZMIZ2 and ZMIZ1 (MIM 607159) are members of a PIAS (see MIM 603566)-like family of proteins that interact with nuclear hormone receptors. ZMIZ2 interacts with androgen receptor (AR; MIM 313700) and enhances AR-mediated transcription (Huang et al., 2005 [PubMed 16051670]).[supplied by OMIM, May 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of ZMIZ2. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTGAAGGCGGCGCCAACAA |
| PCR Primer |
Forward: GATTCCTGCTTCCTCATAGGTTTTG Reverse: CATTCTTTCTAGACCCTCCACTACA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.