ZMIZ2 Knockout Cell Line - CD BioSciences

service-banner

ZMIZ2 Knockout Cell Line

ZMIZ2 Knockout Cell Line

SPL-04051

Size Price
1 Unit Online Inquiry
Description
14bp deletion
Target Information
Target Name ZMIZ2
Gene Abbr. ZMIZ2
Gene ID 83637
Full Name zinc finger MIZ-type containing 2
Alias NET27, TRAFIP20, ZIMP7, hZIMP7
Species Human
Genomic Locus chr7:44757064
Transcript NM_174929
WT Expression Level 17.48 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction ZMIZ2 and ZMIZ1 (MIM 607159) are members of a PIAS (see MIM 603566)-like family of proteins that interact with nuclear hormone receptors. ZMIZ2 interacts with androgen receptor (AR; MIM 313700) and enhances AR-mediated transcription (Huang et al., 2005 [PubMed 16051670]).[supplied by OMIM, May 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of ZMIZ2.
Description 14bp deletion
Parental Cell Line C631
Guide RNA Sequence GCTGAAGGCGGCGCCAACAA
PCR Primer Forward: GATTCCTGCTTCCTCATAGGTTTTG
Reverse: CATTCTTTCTAGACCCTCCACTACA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.