ZFYVE16 Knockout Cell Line - CD BioSciences

service-banner

ZFYVE16 Knockout Cell Line

ZFYVE16 Knockout Cell Line

SPL-04050

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name ZFYVE16
Gene Abbr. ZFYVE16
Gene ID 9765
Full Name zinc finger FYVE-type containing 16
Alias PPP1R69
Species Human
Genomic Locus chr5:80437030
Transcript NM_014733
WT Expression Level 35.48 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes an endosomal protein that belongs to the FYVE zinc finger family of proteins. The encoded protein is thought to regulate membrane trafficking in the endosome. This protein functions as a scaffold protein in the transforming growth factor-beta signaling pathway and is involved in positive and negative feedback regulation of the bone morphogenetic protein signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of ZFYVE16.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence ATCGTCCCATATATAACGGC
PCR Primer Forward: CCTCATCAGAAACAAGCTATGGAAC
Reverse: AATCCAATCCAATCAAGGAATCTGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.