Online Inquiry
ZEB2 Knockout Cell Line
SPL-04045
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 172bp insertion |
| Target Information | |
|---|---|
| Target Name | ZEB2 |
| Gene Abbr. | ZEB2 |
| Gene ID | 9839 |
| Full Name | zinc finger E-box binding homeobox 2 |
| Alias | HSPC082, SIP-1, SIP1, SMADIP1, ZFHX1B |
| Species | Human |
| Genomic Locus | chr2:144404860 |
| Transcript | NM_014795 |
| WT Expression Level | 16.76 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 172bp insertion in a coding exon of ZEB2. |
| Description | 172bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTCTCGCCTTGGCACGCCAG |
| PCR Primer |
Forward: TGGGCTCTAATTGTTCTTGTTCTTT Reverse: TACTTTGCCAAAAGAAAACTGGAGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.