ZAP70 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

ZAP70 cDNA ORF Clone, Human, untagged

ZAP70 cDNA ORF Clone, Human, untagged

SPD-15757

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human zeta-chain (TCR) associated protein kinase 70kDa, transcript variant 1.
Target Information
Species Human
Target Name Zap-70
Gene Abbr. ZAP70
Gene ID 7535
Full Name zeta chain of T cell receptor associated protein kinase 70
Alias ADMIO2, IMD48, SRK, STCD, STD
Introduction The Syk family protein tyrosine kinase Zap-70 is expressed in T and NK cells and plays a critical role in mediating T cell activation in response to T cell receptor (TCR) engagement. Following TCR engagement, Zap-70 is rapidly phosphorylated on several tyrosine residues through autophosphorylation and transphosphorylation by the Src family tyrosine kinase Lck. Tyrosine phosphorylation correlates with increased Zap-70 kinase activity and downstream signaling events. Expression of Zap-70 is correlated with disease progression and survival in patients with chronic lymphocytic leukemia.Phosphorylation of Tyr319 is required for the assembly of a Zap-70-containing signaling complex that leads to the activation of the PLC-gamma1-dependent and Ras-dependent signaling cascades in antigen-stimulated T cells. The orthologous Tyr352 residue in Syk is also involved in the association with PLC-gamma1.
Product Details
Description Full length Clone DNA of Human zeta-chain (TCR) associated protein kinase 70kDa, transcript variant 1.
NCBI Ref Seq NM_001079.3
RefSeq ORF Size 1860 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 1.86kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.