Online Inquiry
ZAP70 cDNA ORF Clone, Human, N-FLAG tag
SPD-15753
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human zeta-chain (TCR) associated protein kinase 70kDa, transcript variant 1 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | Zap-70 |
Gene Abbr. | ZAP70 |
Gene ID | 7535 |
Full Name | zeta chain of T cell receptor associated protein kinase 70 |
Alias | ADMIO2, IMD48, SRK, STCD, STD |
Introduction | The Syk family protein tyrosine kinase Zap-70 is expressed in T and NK cells and plays a critical role in mediating T cell activation in response to T cell receptor (TCR) engagement. Following TCR engagement, Zap-70 is rapidly phosphorylated on several tyrosine residues through autophosphorylation and transphosphorylation by the Src family tyrosine kinase Lck. Tyrosine phosphorylation correlates with increased Zap-70 kinase activity and downstream signaling events. Expression of Zap-70 is correlated with disease progression and survival in patients with chronic lymphocytic leukemia.Phosphorylation of Tyr319 is required for the assembly of a Zap-70-containing signaling complex that leads to the activation of the PLC-gamma1-dependent and Ras-dependent signaling cascades in antigen-stimulated T cells. The orthologous Tyr352 residue in Syk is also involved in the association with PLC-gamma1. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human zeta-chain (TCR) associated protein kinase 70kDa, transcript variant 1 with N terminal Flag tag. |
NCBI Ref Seq | NM_001079.3 |
RefSeq ORF Size | 1860 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.