Ywhaz cDNA ORF Clone, Rat, N-His tag - CD BioSciences

service-banner

Ywhaz cDNA ORF Clone, Rat, N-His tag

Ywhaz cDNA ORF Clone, Rat, N-His tag

SPD-00188

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide with N terminal His tag.
Target Information
Species Rat
Target Name 14-3-3
Gene Abbr. Ywhaz
Gene ID 25578
Full Name tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta
Alias 14-3-3z
Introduction The 14-3-3 family of proteins plays a key regulatory role in signal transduction, checkpoint control, apoptotic and nutrient-sensing pathways. 14-3-3 proteins are highly conserved and ubiquitously expressed. There are at least seven isoforms, β, γ, ε, σ, ζ, τ, and η that have been identified in mammals. The initially described α and δ isoforms are confirmed to be phosphorylated forms of β and ζ, respectively. Through their amino-terminal α helical region, 14-3-3 proteins form homo- or heterodimers that interact with a wide variety of proteins: transcription factors, metabolic enzymes, cytoskeletal proteins, kinases, phosphatases, and other signaling molecules. The interaction of 14-3-3 proteins with their targets is primarily through a phospho-Ser/Thr motif. However, binding to divergent phospho-Ser/Thr motifs, as well as phosphorylation independent interactions has been observed. 14-3-3 binding masks specific sequences of the target protein, and therefore, modulates target protein localization, phosphorylation state, stability, and molecular interactions. 14-3-3 proteins may also induce target protein conformational changes that modify target protein function. Distinct temporal and spatial expression patterns of 14-3-3 isoforms have been observed in development and in acute response to extracellular signals and drugs, suggesting that 14-3-3 isoforms may perform different functions despite their sequence similarities. Several studies suggest that 14-3-3 isoforms are differentially regulated in cancer and neurological syndromes.
Product Details
Description Full length Clone DNA of Rat tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide with N terminal His tag.
NCBI Ref Seq BC094305.1
RefSeq ORF Size 738 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.