Online Inquiry
YES1 Knockout Cell Line
SPL-04030
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 17bp deletion |
| Target Information | |
|---|---|
| Target Name | Yes |
| Gene Abbr. | YES1 |
| Gene ID | 7525 |
| Full Name | YES proto-oncogene 1, Src family tyrosine kinase |
| Alias | HsT441, P61-YES, Yes, c-yes |
| Species | Human |
| Genomic Locus | chr18:756716 |
| Transcript | NM_005433 |
| WT Expression Level | 32.34 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 17bp deletion in a coding exon of YES1. |
| Description | 17bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TAGTGGGTTCTGCTCCATAA |
| PCR Primer |
Forward: GATATGAACTTGGCACCACTGAAAA Reverse: AAGTCCAGCCATTAAATACAGACCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.