Online Inquiry
YES1 cDNA ORF Clone, Human, untagged
SPD-15747
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human YES proto-oncogene 1, Src family tyrosine kinase. |
Target Information | |
---|---|
Species | Human |
Target Name | Yes |
Gene Abbr. | YES1 |
Gene ID | 7525 |
Full Name | YES proto-oncogene 1, Src family tyrosine kinase |
Alias | HsT441, P61-YES, Yes, c-yes |
Introduction | The cellular oncogene c-Yes and its viral homologue v-Yes (the transforming gene of Yamaguchi 73 and Esh avian sarcoma viruses) encode a 60 kDa, cytoplasmic, membrane-associated, protein-tyrosine kinase. Yes belongs to the Src kinase family and is ubiquitously expressed in many tissues and cells. Like other Src family members, Yes contains several conserved functional domains such as an N-terminal myristoylation sequence for membrane targeting, SH2 and SH3 domains, a kinase domain, and a C-terminal non-catalytic domain. Although several lines of evidence support redundancy in signaling between Yes and other Src family kinases, there is also a growing body of evidence indicating specificity in Yes signaling. Yes is activated downstream of a multitude of cell surface receptors, including receptor tyrosine kinases, G protein-coupled receptors, and cytokine receptors. In addition, both Yes and Src kinases are activated during the cell cycle transition from G2 to M phase. Investigators have found that dysfunction of Yes is associated with the development of various cancers. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human YES proto-oncogene 1, Src family tyrosine kinase. |
NCBI Ref Seq | NM_005433.3 |
RefSeq ORF Size | 1632 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Restriction Sites | KpnI + XbaI (6.1kb + 1.63kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.