YES1 cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

YES1 cDNA ORF Clone, Human, N-His tag

YES1 cDNA ORF Clone, Human, N-His tag

SPD-15743

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human YES proto-oncogene 1, Src family tyrosine kinase with N terminal His tag.
Target Information
Species Human
Target Name Yes
Gene Abbr. YES1
Gene ID 7525
Full Name YES proto-oncogene 1, Src family tyrosine kinase
Alias HsT441, P61-YES, Yes, c-yes
Introduction The cellular oncogene c-Yes and its viral homologue v-Yes (the transforming gene of Yamaguchi 73 and Esh avian sarcoma viruses) encode a 60 kDa, cytoplasmic, membrane-associated, protein-tyrosine kinase. Yes belongs to the Src kinase family and is ubiquitously expressed in many tissues and cells. Like other Src family members, Yes contains several conserved functional domains such as an N-terminal myristoylation sequence for membrane targeting, SH2 and SH3 domains, a kinase domain, and a C-terminal non-catalytic domain. Although several lines of evidence support redundancy in signaling between Yes and other Src family kinases, there is also a growing body of evidence indicating specificity in Yes signaling. Yes is activated downstream of a multitude of cell surface receptors, including receptor tyrosine kinases, G protein-coupled receptors, and cytokine receptors. In addition, both Yes and Src kinases are activated during the cell cycle transition from G2 to M phase. Investigators have found that dysfunction of Yes is associated with the development of various cancers.
Product Details
Description Full length Clone DNA of Human YES proto-oncogene 1, Src family tyrosine kinase with N terminal His tag.
NCBI Ref Seq NM_005433.3
RefSeq ORF Size 1632 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.