Online Inquiry
YAP1 Knockout Cell Line
SPL-04029
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
35bp deletion |
Target Information | |
---|---|
Target Name | YAP |
Gene Abbr. | YAP1 |
Gene ID | 10413 |
Full Name | Yes1 associated transcriptional regulator |
Alias | COB1, YAP, YAP2, YAP65, YKI |
Species | Human |
Genomic Locus | chr11:102205955 |
Transcript | NM_006106 |
WT Expression Level | 46.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a downstream nuclear effector of the Hippo signaling pathway which is involved in development, growth, repair, and homeostasis. This gene is known to play a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2013]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 35bp deletion in a coding exon of YAP1. |
Description | 35bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGCCCACAGGGAGGCGTCAT |
PCR Primer |
Forward: AGTTACATCGAATATCCCAAATTGCT Reverse: CTGCCCAACTTTAAGAAAACAAACC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.