YAP1 Knockout Cell Line - CD BioSciences

service-banner

YAP1 Knockout Cell Line

YAP1 Knockout Cell Line

SPL-04029

Size Price
1 Unit Online Inquiry
Description
35bp deletion
Target Information
Target Name YAP
Gene Abbr. YAP1
Gene ID 10413
Full Name Yes1 associated transcriptional regulator
Alias COB1, YAP, YAP2, YAP65, YKI
Species Human
Genomic Locus chr11:102205955
Transcript NM_006106
WT Expression Level 46.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a downstream nuclear effector of the Hippo signaling pathway which is involved in development, growth, repair, and homeostasis. This gene is known to play a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 35bp deletion in a coding exon of YAP1.
Description 35bp deletion
Parental Cell Line C631
Guide RNA Sequence AGCCCACAGGGAGGCGTCAT
PCR Primer Forward: AGTTACATCGAATATCCCAAATTGCT
Reverse: CTGCCCAACTTTAAGAAAACAAACC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.