Online Inquiry
YAP1 cDNA ORF Clone, Human, untagged
SPD-15717
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human Yes associated protein 1 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | YAP |
| Gene Abbr. | YAP1 |
| Gene ID | 10413 |
| Full Name | Yes1 associated transcriptional regulator |
| Alias | COB1, YAP, YAP2, YAP65, YKI |
| Introduction | YAP (Yes-associated protein, YAP65) was first identified based on its ability to associate with the SH3 domain of Yes. It also binds to other SH3 domain-containing proteins such as Nck, Crk, Src, and Abl. In addition to the SH3 binding motif, YAP contains a PDZ interaction motif, a coiled-coil domain, and WW domains. While initial studies of YAP all pointed towards a role in anchoring and targeting to specific subcellular compartments, subsequent studies showed that YAP is a transcriptional co-activator by virtue of its WW domain interacting with the PY motif (PPxY) of the transcription factor PEBP2 and other transcription factors. In its capacity as a transcriptional co-activator, YAP is now widely recognized as a central mediator of the Hippo Pathway, which plays a fundamental and widely conserved role in regulating tissue growth and organ size. Phosphorylation at multiple sites (e.g., Ser109, Ser127) by LATS kinases promotes YAP translocation from the nucleus to the cytoplasm, where it is sequestered through association with 14-3-3 proteins. These LATS-driven phosphorylation events serve to prime YAP for subsequent phosphorylation by CK1δ/ε in an adjacent phosphodegron, triggering proteasomal degradation of YAP. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human Yes associated protein 1 |
| NCBI Ref Seq | NM_001130145.2 |
| RefSeq ORF Size | 1515 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.52kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.