Online Inquiry
XRCC4 Knockout Cell Line
SPL-04021
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | XRCC4 |
| Gene Abbr. | XRCC4 |
| Gene ID | 7518 |
| Full Name | X-ray repair cross complementing 4 |
| Alias | SSMED |
| Species | Human |
| Genomic Locus | chr5:83105026 |
| Transcript | NM_022406 |
| WT Expression Level | 7.58 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternative splicing generates several transcript variants. [provided by RefSeq, Dec 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of XRCC4. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTACTGATGGTCATTCAGCA |
| PCR Primer |
Forward: TGAGAGGCCAGTACAGAAAACATTA Reverse: ACCTGTGTATAAATTTGACAGCAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.