Online Inquiry
XPA Knockout Cell Line
SPL-04018
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | XPA |
| Gene Abbr. | XPA |
| Gene ID | 7507 |
| Full Name | XPA, DNA damage recognition and repair factor |
| Alias | XP1, XPAC |
| Species | Human |
| Genomic Locus | chr9:97693720 |
| Transcript | NM_000380 |
| WT Expression Level | 10.92 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a zinc finger protein involved in DNA excision repair. The encoded protein is part of the NER (nucleotide excision repair) complext which is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens. Mutations in this gene are associated with xeroderma pigmentosum complementation group A. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of XPA. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCCCCAAAGATAATTGACAC |
| PCR Primer |
Forward: ATCTACTAGCAAAACTGCCAAACTT Reverse: AAGTAGTGATTGTGGACATCCTTGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.