Xiap cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Xiap cDNA ORF Clone, Mouse, untagged

Xiap cDNA ORF Clone, Mouse, untagged

SPD-15706

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse X-linked inhibitor of apoptosis.
Target Information
Species Mouse
Target Name XIAP
Gene Abbr. Xiap
Gene ID 11798
Full Name X-linked inhibitor of apoptosis
Alias 1110015C02Rik, A, Aipa, Api3, Bir
Introduction The inhibitor of apoptosis protein (IAP) family consists of an evolutionarily conserved group of apoptosis inhibitors containing a conserved 70 amino acid BIR (baculovirus inhibitor repeat) domain. Human members of this family include c-IAP1, c-IAP2, XIAP, survivin, livin, and NAIP. Overexpression of IAP family members, particularly survivin and livin, in cancer cell lines and primary tumors suggests an important role for these proteins in cancer progression. In general, the IAP proteins function through direct interactions to inhibit the activity of several caspases, including caspase-3, caspase-7, and caspase-9. In addition, binding of IAP family members to the mitochondrial protein Smac blocks their interaction with caspase-9, thereby allowing the processing and activation of the caspase.
Product Details
Description Full length Clone DNA of Mouse X-linked inhibitor of apoptosis.
NCBI Ref Seq NM_009688.2
RefSeq ORF Size 1491 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI (two restriction sites) + XbaI (6.1kb + 0.97kb + 0.52kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.