Online Inquiry
Xiap cDNA ORF Clone, Mouse, N-HA tag
SPD-15705
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse X-linked inhibitor of apoptosis with N terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | XIAP |
Gene Abbr. | Xiap |
Gene ID | 11798 |
Full Name | X-linked inhibitor of apoptosis |
Alias | 1110015C02Rik, A, Aipa, Api3, Bir |
Introduction | The inhibitor of apoptosis protein (IAP) family consists of an evolutionarily conserved group of apoptosis inhibitors containing a conserved 70 amino acid BIR (baculovirus inhibitor repeat) domain. Human members of this family include c-IAP1, c-IAP2, XIAP, survivin, livin, and NAIP. Overexpression of IAP family members, particularly survivin and livin, in cancer cell lines and primary tumors suggests an important role for these proteins in cancer progression. In general, the IAP proteins function through direct interactions to inhibit the activity of several caspases, including caspase-3, caspase-7, and caspase-9. In addition, binding of IAP family members to the mitochondrial protein Smac blocks their interaction with caspase-9, thereby allowing the processing and activation of the caspase. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse X-linked inhibitor of apoptosis with N terminal HA tag. |
NCBI Ref Seq | NM_009688.2 |
RefSeq ORF Size | 1491 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.