Wnt9a cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Wnt9a cDNA ORF Clone, Mouse, untagged

Wnt9a cDNA ORF Clone, Mouse, untagged

SPD-15695

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse wingless-type MMTV integration site 9A.
Target Information
Species Mouse
Target Name Wnt9A
Gene Abbr. Wnt9a
Gene ID 216795
Full Name wingless-type MMTV integration site family, member 9A
Alias Wnt1, Wnt14, wnt-14
Product Details
Description Full length Clone DNA of Mouse wingless-type MMTV integration site 9A.
NCBI Ref Seq NM_139298.2
RefSeq ORF Size 1098 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.