Wnt7a cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Wnt7a cDNA ORF Clone, Mouse, untagged

Wnt7a cDNA ORF Clone, Mouse, untagged

SPD-15674

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse wingless-related MMTV integration site 7A.
Target Information
Species Mouse
Target Name Wnt7A
Gene Abbr. Wnt7a
Gene ID 22421
Full Name wingless-type MMTV integration site family, member 7A
Alias AI849442, Wnt-, Wnt-7a, px, tw
Product Details
Description Full length Clone DNA of Mouse wingless-related MMTV integration site 7A.
NCBI Ref Seq NM_009527.3
RefSeq ORF Size 1050 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.