Wnt5a cDNA ORF Clone, Mouse, N-Myc tag - CD BioSciences

service-banner

Wnt5a cDNA ORF Clone, Mouse, N-Myc tag

Wnt5a cDNA ORF Clone, Mouse, N-Myc tag

SPD-15621

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse wingless-related MMTV integration site 5A with N terminal Myc tag.
Target Information
Species Mouse
Target Name Wnt5a
Gene Abbr. Wnt5a
Gene ID 22418
Full Name wingless-type MMTV integration site family, member 5A
Alias 8030457G12Rik, Wnt-, Wnt-5a
Introduction The Wnt family includes several secreted glycoproteins that play important roles in animal development. There are 19 Wnt genes in the human genome that encode functionally distinct Wnt proteins. Wnt members bind to the Frizzled family of seven-pass transmembrane proteins and activate several signaling pathways. The canonical Wnt/β-catenin pathway also requires a coreceptor from the low-density lipoprotein receptor family. Aberrant activation of Wnt signaling pathways is involved in several types of cancers.Wnt-5a has been shown to signal through the canonical Wnt pathways as well as through non-canonical pathways and is up-regulated in various types of human cancers. In melanoma, Wnt5a is thought to directly affect cell motility and metastasis.
Product Details
Description Full length Clone DNA of Mouse wingless-related MMTV integration site 5A with N terminal Myc tag.
NCBI Ref Seq NM_009524.2
RefSeq ORF Size 1143 bp
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.