Online Inquiry
Wnt5a cDNA ORF Clone, Mouse, C-FLAG tag
SPD-15614
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse wingless-related MMTV integration site 5A with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Wnt5a |
Gene Abbr. | Wnt5a |
Gene ID | 22418 |
Full Name | wingless-type MMTV integration site family, member 5A |
Alias | 8030457G12Rik, Wnt-, Wnt-5a |
Introduction | The Wnt family includes several secreted glycoproteins that play important roles in animal development. There are 19 Wnt genes in the human genome that encode functionally distinct Wnt proteins. Wnt members bind to the Frizzled family of seven-pass transmembrane proteins and activate several signaling pathways. The canonical Wnt/β-catenin pathway also requires a coreceptor from the low-density lipoprotein receptor family. Aberrant activation of Wnt signaling pathways is involved in several types of cancers.Wnt-5a has been shown to signal through the canonical Wnt pathways as well as through non-canonical pathways and is up-regulated in various types of human cancers. In melanoma, Wnt5a is thought to directly affect cell motility and metastasis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse wingless-related MMTV integration site 5A with C terminal Flag tag. |
NCBI Ref Seq | NM_009524.2 |
RefSeq ORF Size | 1143 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.