Online Inquiry
Wnt3a cDNA ORF Clone, Mouse, C-His tag
SPD-15579
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse wingless-type MMTV integration site family, member 3A with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | Wnt3a |
Gene Abbr. | Wnt3a |
Gene ID | 22416 |
Full Name | wingless-type MMTV integration site family, member 3A |
Alias | Wnt-, Wnt-3a, vt |
Introduction | The Wnt family includes several secreted glycoproteins that play important roles in animal development. There are 19 Wnt genes in the human genome that encode functionally distinct Wnt proteins. Wnt members bind to the Frizzled family of seven-pass transmembrane proteins and activate several signaling pathways. The canonical Wnt/β-catenin pathway also requires a coreceptor from the low-density lipoprotein receptor family. Aberrant activation of Wnt signaling pathways is involved in several types of cancers.Wnt3a protein is palmitoylated and can function as a growth factor for hematopoietic stem cells. Although functionally distinct, Wnt3a shows high homology to Wnt3. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse wingless-type MMTV integration site family, member 3A with C terminal His tag. |
NCBI Ref Seq | NM_009522.1 |
RefSeq ORF Size | 1104 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 711T/C,804A/G,846A/G, not causing the amino acid variation. |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Restriction Sites | HindIII + NotI (6kb + 1.1kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.