WNT3A cDNA ORF Clone, Human, C-HA tag - CD BioSciences

service-banner

WNT3A cDNA ORF Clone, Human, C-HA tag

WNT3A cDNA ORF Clone, Human, C-HA tag

SPD-15591

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human Wnt family member 3A
Target Information
Species Human
Target Name Wnt3a
Gene Abbr. WNT3A
Gene ID 89780
Full Name Wnt family member 3A
Introduction The Wnt family includes several secreted glycoproteins that play important roles in animal development. There are 19 Wnt genes in the human genome that encode functionally distinct Wnt proteins. Wnt members bind to the Frizzled family of seven-pass transmembrane proteins and activate several signaling pathways. The canonical Wnt/β-catenin pathway also requires a coreceptor from the low-density lipoprotein receptor family. Aberrant activation of Wnt signaling pathways is involved in several types of cancers.Wnt3a protein is palmitoylated and can function as a growth factor for hematopoietic stem cells. Although functionally distinct, Wnt3a shows high homology to Wnt3.
Product Details
Description Full length Clone DNA of Human Wnt family member 3A
NCBI Ref Seq BC103921
RefSeq ORF Size 1200 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + XbaI (6kb + 1.2kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.