Wnt3 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Wnt3 cDNA ORF Clone, Mouse, untagged

Wnt3 cDNA ORF Clone, Mouse, untagged

SPD-15575

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse wingless-related MMTV integration site 3.
Target Information
Species Mouse
Target Name Wnt3
Gene Abbr. Wnt3
Gene ID 22415
Full Name wingless-type MMTV integration site family, member 3
Alias Int, Int-4, Wnt-, Wnt-3
Product Details
Description Full length Clone DNA of Mouse wingless-related MMTV integration site 3.
NCBI Ref Seq NM_009521.1
RefSeq ORF Size 1068 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6G>A not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 1.07kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.