WNT16 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

WNT16 cDNA ORF Clone, Human, untagged

WNT16 cDNA ORF Clone, Human, untagged

SPD-15555

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human wingless-type MMTV integration site family, member 16.
Target Information
Species Human
Target Name Wnt16
Gene Abbr. WNT16
Gene ID 51384
Full Name Wnt family member 16
Product Details
Description Full length Clone DNA of Human wingless-type MMTV integration site family, member 16.
NCBI Ref Seq NM_057168.1
RefSeq ORF Size 1098 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.