WNK3 Knockout Cell Line - CD BioSciences

service-banner

WNK3 Knockout Cell Line

WNK3 Knockout Cell Line

SPL-04002

Size Price
1 Unit Online Inquiry
Description
20bp deletion
Target Information
Target Name WNK3
Gene Abbr. WNK3
Gene ID 65267
Full Name WNK lysine deficient protein kinase 3
Alias PRKWNK3
Species Human
Genomic Locus chrX:54333571
Transcript NM_020922
WT Expression Level 2.90 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a protein belonging to the 'with no lysine' family of serine-threonine protein kinases. These family members lack the catalytic lysine in subdomain II, and instead have a conserved lysine in subdomain I. This family member functions as a positive regulator of the transcellular Ca2+ transport pathway, and it plays a role in the increase of cell survival in a caspase-3-dependent pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of WNK3.
Description 20bp deletion
Parental Cell Line C631
Guide RNA Sequence CTGTCAAAGTTGCAGCGACC
PCR Primer Forward: CTCTTGGAATATTCATTGCAGCCTT
Reverse: CTGGACTGAAGAGTAGAAACAGGAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.