Online Inquiry
WNK3 Knockout Cell Line
SPL-04000
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
10bp deletion |
Target Information | |
---|---|
Target Name | WNK3 |
Gene Abbr. | WNK3 |
Gene ID | 65267 |
Full Name | WNK lysine deficient protein kinase 3 |
Alias | PRKWNK3 |
Species | Human |
Genomic Locus | chrX:54307964 |
Transcript | NM_001002838 |
WT Expression Level | 2.90 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a protein belonging to the 'with no lysine' family of serine-threonine protein kinases. These family members lack the catalytic lysine in subdomain II, and instead have a conserved lysine in subdomain I. This family member functions as a positive regulator of the transcellular Ca2+ transport pathway, and it plays a role in the increase of cell survival in a caspase-3-dependent pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of WNK3. |
Description | 10bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGAATAAGGATACTCCGATG |
PCR Primer |
Forward: TGGTATAAATCTAAGGCTTGTTGCAT Reverse: TCTATAAGAATGTGGTGGTGGTGTT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.