Online Inquiry
WNK1 Knockout Cell Line
SPL-03996
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | WNK1 |
| Gene Abbr. | WNK1 |
| Gene ID | 65125 |
| Full Name | WNK lysine deficient protein kinase 1 |
| Alias | HSAN2, HSN2, KDP, PPP1R167, PRKWNK1 |
| Species | Human |
| Genomic Locus | chr12:753696 |
| Transcript | NM_014823 |
| WT Expression Level | 87.51 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the WNK subfamily of serine/threonine protein kinases. The encoded protein may be a key regulator of blood pressure by controlling the transport of sodium and chloride ions. Mutations in this gene have been associated with pseudohypoaldosteronism type II and hereditary sensory neuropathy type II. Alternatively spliced transcript variants encoding different isoforms have been described but the full-length nature of all of them has yet to be determined.[provided by RefSeq, May 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of WNK1. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CCTGCCGGTCACAGCGTCGG |
| PCR Primer |
Forward: CGAACCGACCATGTCTGGC Reverse: GGCAGGGAAAGAGGAAGGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.