Online Inquiry
WEE1 cDNA ORF Clone, Human, untagged
SPD-15505
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human WEE1 G2 checkpoint kinase. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Wee1 |
| Gene Abbr. | WEE1 |
| Gene ID | 7465 |
| Full Name | WEE1 G2 checkpoint kinase |
| Alias | WEE1A, WEE1hu |
| Introduction | Entry of all eukaryotic cells into mitosis is regulated by activation of cdc2 kinase. The critical regulatory step in activating cdc2 during progression into mitosis appears to be dephosphorylation of Tyr15 and Thr14. Phosphorylation at Tyr15 and Thr14 and inhibition of cdc2 is carried out by Wee1 and Myt1 protein kinases, while Tyr15 dephosphorylation and activation of cdc2 is carried out by the cdc25 phosphatase. Hyperphosphorylation and inactivation of Myt1 in mitosis suggests that one or more kinases activated at the G2/M transition negatively regulates Myt1 activity. Kinases shown to phosphorylate Myt1 include cdc2, p90RSK, Akt, and Plk1.Akt/PKB-dependent phosphorylation at Ser642 promotes a change in Wee1 localization from nuclear to cytoplasmic and is associated with G2/M arrest. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human WEE1 G2 checkpoint kinase. |
| NCBI Ref Seq | NM_003390.3 |
| RefSeq ORF Size | 1941 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.94kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.