Wasf1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Wasf1 cDNA ORF Clone, Mouse, untagged

Wasf1 cDNA ORF Clone, Mouse, untagged

SPD-15504

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse WAS protein family, member 1.
Target Information
Species Mouse
Target Name WASF1
Gene Abbr. Wasf1
Gene ID 83767
Full Name WAS protein family, member 1
Alias AI195380, AI838537, S, Scar, WA
Product Details
Description Full length Clone DNA of Mouse WAS protein family, member 1.
NCBI Ref Seq NM_031877.3
RefSeq ORF Size 1680 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.