Online Inquiry
VRK3 Knockout Cell Line
SPL-03986
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | VRK3 |
| Gene Abbr. | VRK3 |
| Gene ID | 51231 |
| Full Name | VRK serine/threonine kinase 3 |
| Species | Human |
| Genomic Locus | chr19:50016068 |
| Transcript | NM_001025778 |
| WT Expression Level | 28.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. In both human and mouse, this gene has substitutions at several residues within the ATP binding motifs that in other kinases have been shown to be required for catalysis. In vitro assays indicate the protein lacks phosphorylation activity. The protein, however, likely retains its substrate binding capability. This gene is widely expressed in human tissues and its protein localizes to the nucleus. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of VRK3. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TTGCCTGTAGAGGAGCATGT |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTTCATGTGGCCTCTACCTTGC Reverse: TGGTAGACAGAGGGGTCCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.