VRK1 Knockout Cell Line - CD BioSciences

service-banner

VRK1 Knockout Cell Line

VRK1 Knockout Cell Line

SPL-03983

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name VRK1
Gene Abbr. VRK1
Gene ID 7443
Full Name VRK serine/threonine kinase 1
Alias PCH1, PCH1A
Species Human
Genomic Locus chr14:96847274
Transcript NM_003384
WT Expression Level 86.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of VRK1.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence ACCCGTAAGCTGAAGTACCT
PCR Primer Forward: TGTAAAACGACGGCCAGGGGCAGGATAACAATTTTGTAGGTT
Reverse: ATAAAGGGTGAGCCTAATCTTGTGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.