VPS4A Knockout Cell Line - CD BioSciences

service-banner

VPS4A Knockout Cell Line

VPS4A Knockout Cell Line

SPL-03977

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name VPS4A
Gene Abbr. VPS4A
Gene ID 27183
Full Name vacuolar protein sorting 4 homolog A
Alias SKD1, SKD1A, SKD2, VPS4, VPS4-1
Species Human
Genomic Locus chr16:69318847
Transcript NM_013245
WT Expression Level 24.67 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. The mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be really an yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 16; the gene for the other resides on chromosome 18. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of VPS4A.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence CACGTCGTTCCACCGTATGT
PCR Primer Forward: AGGGGATAATCCGGAGAAAAAGAAA
Reverse: TTTTACATTGGGGTTTGAAATGGCT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.