Online Inquiry
VPS4A Knockout Cell Line
SPL-03973
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
16bp deletion |
Target Information | |
---|---|
Target Name | VPS4A |
Gene Abbr. | VPS4A |
Gene ID | 27183 |
Full Name | vacuolar protein sorting 4 homolog A |
Alias | SKD1, SKD1A, SKD2, VPS4, VPS4-1 |
Species | Human |
Genomic Locus | chr16:69316267 |
Transcript | NM_013245 |
WT Expression Level | 24.67 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. The mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be really an yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 16; the gene for the other resides on chromosome 18. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of VPS4A. |
Description | 16bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGTGCGTGCAGTACCTAGAC |
PCR Primer |
Forward: GAGTACTTCCTCCACGCTATCAAG Reverse: CATCCCTGCACTATGAGGACCATTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.