Online Inquiry
VPS35 Knockout Cell Line
SPL-03969
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp deletion |
Target Information | |
---|---|
Target Name | VPS35 |
Gene Abbr. | VPS35 |
Gene ID | 55737 |
Full Name | VPS35 retromer complex component |
Alias | MEM3, PARK17 |
Species | Human |
Genomic Locus | chr16:46680802 |
Transcript | NM_018206 |
WT Expression Level | 75.00 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene belongs to a group of vacuolar protein sorting (VPS) genes. The encoded protein is a component of a large multimeric complex, termed the retromer complex, involved in retrograde transport of proteins from endosomes to the trans-Golgi network. The close structural similarity between the yeast and human proteins that make up this complex suggests a similarity in function. Expression studies in yeast and mammalian cells indicate that this protein interacts directly with VPS35, which serves as the core of the retromer complex. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of VPS35. |
Description | 2bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TCAAGTCATTTCCTCAGTCC |
PCR Primer |
Forward: CAAATGCTACCTAAATGGCTGACTG Reverse: TGTTTTGTTCAGTGTGTTTGGAAAT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.