VKORC1L1 Knockout Cell Line - CD BioSciences

service-banner

VKORC1L1 Knockout Cell Line

VKORC1L1 Knockout Cell Line

SPL-03963

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name VKORC1L1
Gene Abbr. VKORC1L1
Gene ID 154807
Full Name vitamin K epoxide reductase complex subunit 1 like 1
Species Human
Genomic Locus chr7:65954075
Transcript NM_173517
WT Expression Level 24.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes an enzyme important in the vitamin K cycle, which is involved in the carboxylation of glutamate residues present in vitamin K-dependent proteins. The encoded enzyme catalyzes the de-epoxidation of vitamin K 2,3-epoxide. Oxidative stress may upregulate expression of this gene and the encoded protein may protect cells and membrane proteins form oxidative damage. This gene and a related gene (Gene ID: 79001) may have arisen by gene duplication of an ancestral gene. [provided by RefSeq, Oct 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of VKORC1L1.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence CATGACAGCAAGCGCTGTGG
PCR Primer Forward: TCAACTGCAGAGTCAACCTGTATAA
Reverse: TCGTTCAAGTAAACTAGTCGTTTGT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.