Online Inquiry
VKORC1 Knockout Cell Line
SPL-03961
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | VKORC1 |
| Gene Abbr. | VKORC1 |
| Gene ID | 79001 |
| Full Name | vitamin K epoxide reductase complex subunit 1 |
| Alias | EDTP308, MST134, MST576, VKCFD2, VKOR |
| Species | Human |
| Genomic Locus | chr16:31094568 |
| Transcript | NM_024006 |
| WT Expression Level | 75.77 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes the catalytic subunit of the vitamin K epoxide reductase complex, which is responsible for the reduction of inactive vitamin K 2,3-epoxide to active vitamin K in the endoplasmic reticulum membrane. Vitamin K is a required co-factor for carboxylation of glutamic acid residues by vitamin K-dependent gamma-carboxylase in blood-clotting enzymes. Allelic variation in this gene is associated with vitamin k-dependent clotting factors combined deficiency of 2, and increased resistance or sensitivity to warfarin, an inhibitor of vitamin K epoxide reductase. Pseudogenes of this gene are located on chromosomes 1 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of VKORC1. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACGCGCGAACAGCTGATGG |
| PCR Primer |
Forward: CTCTTATTTCGAACACCAGTATCGC Reverse: GGAACCTGGAGATAATGGGCAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.