Online Inquiry
VIM Knockout Cell Line
SPL-03958
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 221bp insertion |
| Target Information | |
|---|---|
| Target Name | VIM |
| Gene Abbr. | VIM |
| Gene ID | 7431 |
| Full Name | vimentin |
| Species | Human |
| Genomic Locus | chr10:17229911 |
| Transcript | NM_003380 |
| WT Expression Level | 71.75 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the intermediate filament family. Intermediate filamentents, along with microtubules and actin microfilaments, make up the cytoskeleton. The protein encoded by this gene is responsible for maintaining cell shape, integrity of the cytoplasm, and stabilizing cytoskeletal interactions. It is also involved in the immune response, and controls the transport of low-density lipoprotein (LDL)-derived cholesterol from a lysosome to the site of esterification. It functions as an organizer of a number of critical proteins involved in attachment, migration, and cell signaling. Mutations in this gene causes a dominant, pulverulent cataract.[provided by RefSeq, Jun 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 221bp insertion in a coding exon of VIM. |
| Description | 221bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGGCTTTGTCGTTGGTTAGC |
| PCR Primer |
Forward: CTTCCTGGAGCAGCAGAATAAGAT Reverse: AGAAATCTGTAACTTGAAACGGAGC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.