Online Inquiry
VEGFB Knockout Cell Line
SPL-03956
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 170bp deletion |
| Target Information | |
|---|---|
| Target Name | VEGF |
| Gene Abbr. | VEGFB |
| Gene ID | 7423 |
| Full Name | vascular endothelial growth factor B |
| Alias | VEGFL, VRF |
| Species | Human |
| Genomic Locus | chr11:64235921 |
| Transcript | NM_003377 |
| WT Expression Level | 61.16 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 170bp deletion in a coding exon of VEGFB. |
| Description | 170bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCGCTGCACAGTCACGCAGC |
| PCR Primer |
Forward: TCTGCTCCCAGTGGTGTCAT Reverse: TCTAAGACTGAAGGGAGAAAAGCTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.