VEGFA cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

VEGFA cDNA ORF Clone, Rhesus, untagged

VEGFA cDNA ORF Clone, Rhesus, untagged

SPD-15463

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus vascular endothelial growth factor A transcript variant 2.
Target Information
Species Rhesus
Target Name VEGFA
Gene Abbr. VEGFA
Gene ID 574209
Full Name vascular endothelial growth factor A
Product Details
Description Full length Clone DNA of Rhesus vascular endothelial growth factor A transcript variant 2.
NCBI Ref Seq NM_001278385.1
RefSeq ORF Size 576 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.