Online Inquiry
VAV1 cDNA ORF Clone, Human, untagged
SPD-15403
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human vav guanine nucleotide exchange factor 1 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Vav1 |
| Gene Abbr. | VAV1 |
| Gene ID | 7409 |
| Full Name | vav guanine nucleotide exchange factor 1 |
| Alias | VAV |
| Introduction | Vav proteins belong to the Dbl family of guanine nucleotide exchange factors (GEFs) for Rho/Rac small GTPases. The three identified mammalian Vav proteins (Vav1, Vav2 and Vav3) differ in their expression. Vav1 is expressed only in hematopoietic cells and is involved in the formation of the immune synapse. Vav2 and Vav3 are more ubiquitously expressed. Vav proteins contain the Dbl homology domain, which confers GEF activity, as well as protein interaction domains that allow them to function in pathways regulating actin cytoskeleton organization. Phosphorylation stimulates the GEF activity of Vav protein towards Rho/Rac. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human vav guanine nucleotide exchange factor 1 |
| NCBI Ref Seq | NM_005428.3 |
| RefSeq ORF Size | 2538 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 2.54kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.