Online Inquiry
Vasp cDNA ORF Clone, Mouse, N-FLAG tag
SPD-15387
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse vasodilator-stimulated phosphoprotein with N terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | VASP |
Gene Abbr. | Vasp |
Gene ID | 22323 |
Full Name | vasodilator-stimulated phosphoprotein |
Introduction | Vasodilator-stimulated phosphoprotein (VASP) was originally characterized as a substrate of both cGMP- and cAMP-dependent kinases (PKG and PKA, or cGPK and cAPK, respectively). It is now believed that VASP belongs to the Ena/VASP family of adaptor proteins linking the cytoskeletal system to the signal transduction pathways and that it functions in cytoskeletal organization, fibroblast migration, platelet activation and axon guidance. Three phosphorylation sites, Ser157, Ser239, and Thr278, have been identified. Ser239 is the major PKG phosphorylation site while Ser157 is the major PKA phosphorylation site. Evidence suggests that VASP phosphorylation reduces its association with actin and has a negative effect on actin polymerization. Phosphorylation at Ser239 of VASP is a useful marker for monitoring PKG activation and signaling. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse vasodilator-stimulated phosphoprotein with N terminal Flag tag. |
NCBI Ref Seq | NM_009499.3 |
RefSeq ORF Size | 1128 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.