VASP cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

VASP cDNA ORF Clone, Human, untagged

VASP cDNA ORF Clone, Human, untagged

SPD-15402

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human vasodilator-stimulated phosphoprotein.
Target Information
Species Human
Target Name VASP
Gene Abbr. VASP
Gene ID 7408
Full Name vasodilator stimulated phosphoprotein
Introduction Vasodilator-stimulated phosphoprotein (VASP) was originally characterized as a substrate of both cGMP- and cAMP-dependent kinases (PKG and PKA, or cGPK and cAPK, respectively). It is now believed that VASP belongs to the Ena/VASP family of adaptor proteins linking the cytoskeletal system to the signal transduction pathways and that it functions in cytoskeletal organization, fibroblast migration, platelet activation and axon guidance. Three phosphorylation sites, Ser157, Ser239, and Thr278, have been identified. Ser239 is the major PKG phosphorylation site while Ser157 is the major PKA phosphorylation site. Evidence suggests that VASP phosphorylation reduces its association with actin and has a negative effect on actin polymerization. Phosphorylation at Ser239 of VASP is a useful marker for monitoring PKG activation and signaling.
Product Details
Description Full length Clone DNA of Human vasodilator-stimulated phosphoprotein.
NCBI Ref Seq BC038224
RefSeq ORF Size 1143 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.