Online Inquiry
VAMP1 Knockout Cell Line
SPL-03946
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 163bp insertion |
| Target Information | |
|---|---|
| Target Name | VAMP1 |
| Gene Abbr. | VAMP1 |
| Gene ID | 6843 |
| Full Name | vesicle associated membrane protein 1 |
| Alias | CMS25, SPAX1, SYB1, VAMP-1 |
| Species | Human |
| Genomic Locus | chr12:6465869 |
| Transcript | NM_199245 |
| WT Expression Level | 12.47 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 163bp insertion in a coding exon of VAMP1. |
| Description | 163bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCAGTGCTGCCAAGCTAAAG |
| PCR Primer |
Forward: TGCACCATTAGAGGGAAGAAATGTA Reverse: GACTTGTGATTCTCTGGTTGTTGTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.