Online Inquiry
VAC14 Knockout Cell Line
SPL-03944
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | VAC14 |
| Gene Abbr. | VAC14 |
| Gene ID | 55697 |
| Full Name | VAC14 component of PIKFYVE complex |
| Alias | ArPIKfyve, TAX1BP2, TRX |
| Species | Human |
| Genomic Locus | chr16:70786260 |
| Transcript | NM_018052 |
| WT Expression Level | 40.39 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a scaffold protein that is a component of the PIKfyve protein kinase complex. This complex is responsible for the synthesis of phosphatidylinositol 3,5-bisphosphate, an important component of cellular membranes, from phosphatidylinositol 3-phosphate. Mice lacking a functional copy of this gene exhibit severe neurodegeneration. Mutations in the human gene have been identified in patients with a childhood onset progressive neurological disorder characterized by impaired movement, dystonia, and striatal abnormalities. [provided by RefSeq, May 2017]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of VAC14. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGCACCCCCACAGCCGGAAA |
| PCR Primer |
Forward: AATAAAACATAGGTCTGCAATGCCC Reverse: TTTCCTCTTTCCAAACAGGTCATCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.