USP48 Knockout Cell Line - CD BioSciences

service-banner

USP48 Knockout Cell Line

USP48 Knockout Cell Line

SPL-03929

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name USP48
Gene Abbr. USP48
Gene ID 84196
Full Name ubiquitin specific peptidase 48
Alias RAP1GA1, USP31
Species Human
Genomic Locus chr1:21782856
Transcript NM_001032730
WT Expression Level 67.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of USP48.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence TCGAGACCGCTTACCGCATC
PCR Primer Forward: GATGGGAACCCAAACCTTCCTAAAG
Reverse: CTCGGGAGGCGTTCCTGG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.